Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 3773662
End position: 3773688
Length: 27

DNA sequence
>NC_020209, from 3773662 to 3773688 (27 bp); Pseudomonas poae RE*1-1-14 AACCGCCGTCACCGCCGTCACCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3772569-3773792	Sequence	H045_16525 obgE GTPase CgtA (Protein is coded in complementary strand; from 3773792 to 3772569)