Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 3599692
End position: 3599718
Length: 27

DNA sequence
>NC_020209, from 3599692 to 3599718 (27 bp); Pseudomonas poae RE*1-1-14 CATGCCGCCCATGCCACCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3599687-3601333	Sequence	H045_15770 groEL chaperonin GroEL (Protein is coded in complementary strand; from 3601333 to 3599687)