Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 3372787
End position: 3372816
Length: 30

DNA sequence
>NC_020209, from 3372787 to 3372816 (30 bp); Pseudomonas poae RE*1-1-14 TTGCGACTGCTTGATACTGCTTCCGCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3372767-3373489	Sequence	H045_14700 flgD flagellar basal body rod modification protein (Protein is coded in complementary strand; from 3373489 to 3372767)