Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 3167895
End position: 3167918
Length: 24

DNA sequence
>NC_020209, from 3167895 to 3167918 (24 bp); Pseudomonas poae RE*1-1-14 GTCGGCGTGGGCATCGGCGTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3167250-3169262	Sequence	H045_13715 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 3169262 to 3167250)