Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 3021212
End position: 3021235
Length: 24

DNA sequence
>NC_020209, from 3021212 to 3021235 (24 bp); Pseudomonas poae RE*1-1-14 CTGCTGTTGCTGTTGCTGCTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3021078-3022304	Sequence	H045_13070 - flagellar hook-length control protein (Protein is coded in complementary strand; from 3022304 to 3021078)