Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 2566458
End position: 2566481
Length: 24

DNA sequence
>NC_020209, from 2566458 to 2566481 (24 bp); Pseudomonas poae RE*1-1-14 CATCGGCATCGCCATGGGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2565542-2566561	Sequence	H045_11050 murB UDP-N-acetylenolpyruvoylglucosamine reductase (Protein is coded in complementary strand; from 2566561 to 2565542)