Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 2180059
End position: 2180082
Length: 24

DNA sequence
>NC_020209, from 2180059 to 2180082 (24 bp); Pseudomonas poae RE*1-1-14 CGATGGCGATGCCGTTGGCGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2177991-2182859	Sequence	H045_09595 - NAD-glutamate dehydrogenase (Protein is coded in complementary strand; from 2182859 to 2177991)