Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 2090625
End position: 2090648
Length: 24

DNA sequence
>NC_020209, from 2090625 to 2090648 (24 bp); Pseudomonas poae RE*1-1-14 CACCAGCAGCAGGACCAGCACCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2089747-2090727	Sequence	H045_09235 - putative sugar ABC transporter membrane protein (Protein is coded in complementary strand; from 2090727 to 2089747)