Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 1187792
End position: 1187827
Length: 36

DNA sequence
>NC_020209, from 1187792 to 1187827 (36 bp); Pseudomonas poae RE*1-1-14 CGGTGCCGGTGCCGGTGCCGGTGCCGGTGCCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1187472-1188236	Sequence	H045_05515 - TonB domain-containing protein (Protein is coded in complementary strand; from 1188236 to 1187472)