Sequence retrieval

Genome: Pseudomonas poae RE*1-1-14
Start position: 1185072
End position: 1185095
Length: 24

DNA sequence
>NC_020209, from 1185072 to 1185095 (24 bp); Pseudomonas poae RE*1-1-14 CGATGGCGATGAAGATGGCGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1184504-1185151	Sequence	H045_05505 - transporter, MotA/TolQ/ExbB proton channel family protein (Protein is coded in complementary strand; from 1185151 to 1184504)