Sequence retrieval

Genome: Enterococcus faecium NRRL B-2354
Start position: 2309782
End position: 2309805
Length: 24

DNA sequence
>NC_020207, from 2309782 to 2309805 (24 bp); Enterococcus faecium NRRL B-2354 TCTTTTGCTTTTTGTTTTTCTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2308036-2311164	Sequence	M7W_2446 - Exonuclease SbcC (Protein is coded in complementary strand; from 2311164 to 2308036)