Sequence retrieval

Genome: Enterococcus faecium NRRL B-2354
Start position: 1952755
End position: 1952778
Length: 24

DNA sequence
>NC_020207, from 1952755 to 1952778 (24 bp); Enterococcus faecium NRRL B-2354 TTTCTGTTTTTGTTTCTGTATCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1952412-1954604	Sequence	M7W_2108 - Cell division protein FtsI, Peptidoglycan synthetase (Protein is coded in complementary strand; from 1954604 to 1952412)