Sequence retrieval

Genome: Enterococcus faecium NRRL B-2354
Start position: 1916881
End position: 1916904
Length: 24

DNA sequence
>NC_020207, from 1916881 to 1916904 (24 bp); Enterococcus faecium NRRL B-2354 TCTTTATCTATATCTATATCTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1916530-1917363	Sequence	M7W_2067 - Phage replication initiation (Protein is coded in complementary strand; from 1917363 to 1916530)