Sequence retrieval

Genome: Enterococcus faecium NRRL B-2354
Start position: 1839810
End position: 1839839
Length: 30

DNA sequence
>NC_020207, from 1839810 to 1839839 (30 bp); Enterococcus faecium NRRL B-2354 TTATTGTTATTATTTTTGTTATTGTTATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1838940-1839842	Sequence	M7W_1972 - General stress protein, Gls24 family (Protein is coded in complementary strand; from 1839842 to 1838940)