Sequence retrieval

Genome: Enterococcus faecium NRRL B-2354
Start position: 1172500
End position: 1172524
Length: 25

DNA sequence
>NC_020207, from 1172500 to 1172524 (25 bp); Enterococcus faecium NRRL B-2354 AAACAATACAAAACAAAACAAGACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1172076-1172966	Sequence	M7W_1337 - Replication initiation and membrane attachment