Sequence retrieval

Genome: Enterococcus faecium NRRL B-2354
Start position: 108146
End position: 108170
Length: 25

DNA sequence
>NC_020207, from 108146 to 108170 (25 bp); Enterococcus faecium NRRL B-2354 TTTTTTTCTTTTTTGGTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 108124-108576	Sequence	M7W_333 - hypothetical protein (Protein is coded in complementary strand; from 108576 to 108124)