Sequence retrieval

Genome: Enterococcus faecium NRRL B-2354
Start position: 1029716
End position: 1029739
Length: 24

DNA sequence
>NC_020207, from 1029716 to 1029739 (24 bp); Enterococcus faecium NRRL B-2354 AGATAAAGATCAAGATACCGATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1029643-1029864	Sequence	M7W_1202 - Maltose, maltodextrin ABC transporter, permease protein MalF (Protein is coded in complementary strand; from 1029864 to 1029643)