Sequence retrieval

Genome: Blattabacterium sp. (Blatta orientalis) str. Tarazona
Start position: 7266
End position: 7290
Length: 25

DNA sequence
>NC_020195, from 7266 to 7290 (25 bp); Blattabacterium sp. (Blatta orientalis) str. Tarazona TATTTCATTTTATTTTATTATATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7032-8765	Sequence	BLBBOR_007 - ABC transporter ATP-binding protein/permease