Sequence retrieval

Genome: Blattabacterium sp. (Blatta orientalis) str. Tarazona
Start position: 61833
End position: 61857
Length: 25

DNA sequence
>NC_020195, from 61833 to 61857 (25 bp); Blattabacterium sp. (Blatta orientalis) str. Tarazona TATTTTGTTTTTTTTCATTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 61639-62739	Sequence	BLBBOR_063 - peptide chain release factor 2 (Protein is coded in complementary strand; from 62739 to 61639)