Sequence retrieval

Genome: Blattabacterium sp. (Blatta orientalis) str. Tarazona
Start position: 612019
End position: 612054
Length: 36

DNA sequence
>NC_020195, from 612019 to 612054 (36 bp); Blattabacterium sp. (Blatta orientalis) str. Tarazona AAATTTATTTTTCTATTTATTTTTTAAATTATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 612032-613486	Sequence	BLBBOR_602 - polysaccharide biosynthesis protein (Protein is coded in complementary strand; from 613486 to 612032)