Sequence retrieval

Genome: Blattabacterium sp. (Blatta orientalis) str. Tarazona
Start position: 338548
End position: 338580
Length: 33

DNA sequence
>NC_020195, from 338548 to 338580 (33 bp); Blattabacterium sp. (Blatta orientalis) str. Tarazona ATATAAAATAAATATGAAATGAAAATAATATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 337213-338550	Sequence	BLBBOR_339 - Mn2 /Fe2 transporter, NRAMP family (Protein is coded in complementary strand; from 338550 to 337213)