Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 58940
End position: 58963
Length: 24

DNA sequence
>NC_020163, from 58940 to 58963 (24 bp); Escherichia coli APEC O78 AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 58233-59267	Sequence	APECO78_00295 - rhamnose-proton symporter (Protein is coded in complementary strand; from 59267 to 58233)