Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 4751353
End position: 4751388
Length: 36

DNA sequence
>NC_020163, from 4751353 to 4751388 (36 bp); Escherichia coli APEC O78 GGTGCAGGTGCAGGTGCAGGTGCAGGTGCAGGTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4751314-4752519	Sequence	APECO78_22845 - uroporphyrinogen III C-methyltransferase (Protein is coded in complementary strand; from 4752519 to 4751314)