Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 4460845
End position: 4460868
Length: 24

DNA sequence
>NC_020163, from 4460845 to 4460868 (24 bp); Escherichia coli APEC O78 CACCAGCACCAGCGCCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4460405-4461307	Sequence	APECO78_21520 - dipeptide transporter (Protein is coded in complementary strand; from 4461307 to 4460405)