Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 3905719
End position: 3905743
Length: 25

DNA sequence
>NC_020163, from 3905719 to 3905743 (25 bp); Escherichia coli APEC O78 CCTTTGCTTTCTTTTCCTTGCGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3905743-3905829	Sequence	APECO78_18820 - hypothetical protein (Protein is coded in complementary strand; from 3905829 to 3905743)