Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 3208899
End position: 3208923
Length: 25

DNA sequence
>NC_020163, from 3208899 to 3208923 (25 bp); Escherichia coli APEC O78 ACGGAACAGATCGGAACGAATCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3208549-3209481	Sequence	APECO78_15470 - N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase (Protein is coded in complementary strand; from 3209481 to 3208549)