Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 2854165
End position: 2854189
Length: 25

DNA sequence
>NC_020163, from 2854165 to 2854189 (25 bp); Escherichia coli APEC O78 GCACACCACAGAACACCACATCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2854122-2854856	Sequence	APECO78_13890 - putative capsular polysaccharide (Protein is coded in complementary strand; from 2854856 to 2854122)