Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 1844621
End position: 1844644
Length: 24

DNA sequence
>NC_020163, from 1844621 to 1844644 (24 bp); Escherichia coli APEC O78 ATTGGGATTGTGATTGGCATTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1844556-1845728	Sequence	APECO78_08970 - trimethylamine N-oxide reductase cytochrome c-type subunit