Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 1286812
End position: 1286856
Length: 45

DNA sequence
>NC_020163, from 1286812 to 1286856 (45 bp); Escherichia coli APEC O78 GACGCATCAAATTTTGACGGGTCAGATTTTGATGCGTCAGATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1286236-1287009	Sequence	APECO78_06315 - phage replication protein O (Protein is coded in complementary strand; from 1287009 to 1286236)