Sequence retrieval

Genome: Escherichia coli APEC O78
Start position: 118752
End position: 118781
Length: 30

DNA sequence
>NC_020163, from 118752 to 118781 (30 bp); Escherichia coli APEC O78 CGCGGTAAATCTCGATAAATGGCGGTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 117641-118792	Sequence	APECO78_00575 - acetylornithine deacetylase (Protein is coded in complementary strand; from 118792 to 117641)