Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 516166
End position: 516210
Length: 45

DNA sequence
>NC_020059, from 516166 to 516210 (45 bp); Rhizobium tropici CIAT 899 CCGGCGCCTGATTACCCTGGGCCTGATTACCCCCCGCCTGATTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 515928-516611	Sequence	RTCIAT899_CH02530 - hypothetical protein (Protein is coded in complementary strand; from 516611 to 515928)