Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 1654961
End position: 1655000
Length: 40

DNA sequence
>NC_020059, from 1654961 to 1655000 (40 bp); Rhizobium tropici CIAT 899 GAACGTGACGTAGCGTGACGTAGCGTGACGTAGCGTGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1653882-1654979	Sequence	RTCIAT899_CH08130 - putative regulatory prophage protein