Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 122497
End position: 122532
Length: 36

DNA sequence
>NC_020059, from 122497 to 122532 (36 bp); Rhizobium tropici CIAT 899 GCCGAGATCGCGGCCGAAATCGCGGGCGAGAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 122147-123079	Sequence	RTCIAT899_CH00575 - tRNA pseudouridine synthase (Protein is coded in complementary strand; from 123079 to 122147)