Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 747104
End position: 747133
Length: 30

DNA sequence
>NC_020059, from 747104 to 747133 (30 bp); Rhizobium tropici CIAT 899 TCGGCATCGGCATCGGCATCGGCATCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 744539-748204	Sequence	RTCIAT899_CH03620 - two component sensor kinase (Protein is coded in complementary strand; from 748204 to 744539)