Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 811395
End position: 811421
Length: 27

DNA sequence
>NC_020059, from 811395 to 811421 (27 bp); Rhizobium tropici CIAT 899 CCATGCCGCCCATGCCGCCCATGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 811385-813025	Sequence	RTCIAT899_CH03955 groEL chaperonin GroEL (Protein is coded in complementary strand; from 813025 to 811385)