Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 3637622
End position: 3637648
Length: 27

DNA sequence
>NC_020059, from 3637622 to 3637648 (27 bp); Rhizobium tropici CIAT 899 CCGATCAGCACGATCAGCCCGATCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3637280-3640456	Sequence	RTCIAT899_CH17915 - resistance nodulation cell division (RND) drug efflux pump, inner membrane component (Protein is coded in complementary strand; from 3640456 to 3637280)