Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 2332608
End position: 2332634
Length: 27

DNA sequence
>NC_020059, from 2332608 to 2332634 (27 bp); Rhizobium tropici CIAT 899 CACCGCTTCCATCGCTTCCGCCGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2331433-2333091	Sequence	RTCIAT899_CH11520 - acetolactate synthase, catalytic subunit