Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 596885
End position: 596908
Length: 24

DNA sequence
>NC_020059, from 596885 to 596908 (24 bp); Rhizobium tropici CIAT 899 TTGAGGCTGAGGTTCAGGCTGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 596397-597605	Sequence	RTCIAT899_CH02945 - hypothetical protein (Protein is coded in complementary strand; from 597605 to 596397)