Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 3493995
End position: 3494018
Length: 24

DNA sequence
>NC_020059, from 3493995 to 3494018 (24 bp); Rhizobium tropici CIAT 899 TGCCTGTGTCTGCGCCTGGGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3493465-3494133	Sequence	RTCIAT899_CH17275 - outer membrane lipoprotein carrier protein LolA (Protein is coded in complementary strand; from 3494133 to 3493465)