Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 3449027
End position: 3449050
Length: 24

DNA sequence
>NC_020059, from 3449027 to 3449050 (24 bp); Rhizobium tropici CIAT 899 CTGCGTCTGCGTCTGCTTCTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3448554-3449180	Sequence	RTCIAT899_CH17030 - hypothetical protein (Protein is coded in complementary strand; from 3449180 to 3448554)