Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 2721965
End position: 2721988
Length: 24

DNA sequence
>NC_020059, from 2721965 to 2721988 (24 bp); Rhizobium tropici CIAT 899 CCGCGGCCGCGCCCGCCGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2721919-2723346	Sequence	RTCIAT899_CH13545 - transcriptional regulator, GntR family (Protein is coded in complementary strand; from 2723346 to 2721919)