Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 2124360
End position: 2124383
Length: 24

DNA sequence
>NC_020059, from 2124360 to 2124383 (24 bp); Rhizobium tropici CIAT 899 TCATGATCGTGATCATGGCCATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2124333-2125205	Sequence	RTCIAT899_CH10500 - high-affinity zinc ABC uptake transporter, ZnuC-like ATP-binding protein (Protein is coded in complementary strand; from 2125205 to 2124333)