Sequence retrieval

Genome: Rhizobium tropici CIAT 899
Start position: 1013543
End position: 1013566
Length: 24

DNA sequence
>NC_020059, from 1013543 to 1013566 (24 bp); Rhizobium tropici CIAT 899 CGCCGATGCCGACGCAGACGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1012531-1014000	Sequence	RTCIAT899_CH04950 betB betaine aldehyde dehydrogenase (Protein is coded in complementary strand; from 1014000 to 1012531)