Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 972235
End position: 972270
Length: 36

DNA sequence
>NC_019970, from 972235 to 972270 (36 bp); Thermoanaerobacterium thermosaccharolyticum M0795 GCCTCTTTCAATACCTTTTTCAATACCTTTTTCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 972119-972946	Sequence	Thethe_00967 - hypothetical protein (Protein is coded in complementary strand; from 972946 to 972119)