Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 2772769
End position: 2772793
Length: 25

DNA sequence
>NC_019970, from 2772769 to 2772793 (25 bp); Thermoanaerobacterium thermosaccharolyticum M0795 TTTAATGTAATCTAAGTTAATGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2772758-2774056	Sequence	Thethe_02765 - iron-only hydrogenase maturation protein HydE (Protein is coded in complementary strand; from 2774056 to 2772758)