Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 2589347
End position: 2589370
Length: 24

DNA sequence
>NC_019970, from 2589347 to 2589370 (24 bp); Thermoanaerobacterium thermosaccharolyticum M0795 TTATCTTTATATTTATCCTTATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2588689-2589624	Sequence	Thethe_02607 - fructose-1-phosphate kinase (Protein is coded in complementary strand; from 2589624 to 2588689)