Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 2456317
End position: 2456346
Length: 30

DNA sequence
>NC_019970, from 2456317 to 2456346 (30 bp); Thermoanaerobacterium thermosaccharolyticum M0795 TATTTATTTTTATTTCTTCTTTTTTATTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2454618-2457302	Sequence	Thethe_02485 - transcriptional antiterminator (Protein is coded in complementary strand; from 2457302 to 2454618)