Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 2393234
End position: 2393260
Length: 27

DNA sequence
>NC_019970, from 2393234 to 2393260 (27 bp); Thermoanaerobacterium thermosaccharolyticum M0795 CAAAATCAGCAAAAACAGCAAAATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2392233-2393303	Sequence	Thethe_02428 - ABC-type xylose transport system, periplasmic component (Protein is coded in complementary strand; from 2393303 to 2392233)