Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 2318697
End position: 2318732
Length: 36

DNA sequence
>NC_019970, from 2318697 to 2318732 (36 bp); Thermoanaerobacterium thermosaccharolyticum M0795 ACCTTTCTCTATACCTTTCTCTATACCTTTCTCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2318581-2319444	Sequence	Thethe_02357 - hypothetical protein (Protein is coded in complementary strand; from 2319444 to 2318581)