Sequence retrieval

Genome: Thermoanaerobacterium thermosaccharolyticum M0795
Start position: 2087653
End position: 2087697
Length: 45

DNA sequence
>NC_019970, from 2087653 to 2087697 (45 bp); Thermoanaerobacterium thermosaccharolyticum M0795 TTCTATTTCTTCAACTTCATCTTCTTCAACTTCATCTTCTTCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2087507-2088157	Sequence	Thethe_02122 - carbon dioxide concentrating mechanism/carboxysome shell protein (Protein is coded in complementary strand; from 2088157 to 2087507)